Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

  • For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences, or substrings, that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1
Inputs = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output["AAAAACCCCC","CCCCCAAAAA"]
The 10-letter-long sequences "AAAAACCCCC" and "CCCCCAAAAA" each occur more than once.
Example 2
Inputs = "AAAAAAAAAAAAA"
Output["AAAAAAAAAA"]
The 10-letter-long sequence "AAAAAAAAAA" occurs more than once in the string.

Constraints

  • 1 <= s.length <= 10^5
  • s[i] is either 'A', 'C', 'G', or 'T'.

Asked at 7 companies

</>

Your Solution

(Ctrl/Cmd + Enter)

Switching Language

Loading template...

Loading...

Sign in to save your progress

AI code evaluation

Get a correctness verdict, missed edge cases, and complexity analysis of your solution.

Sign in to evaluate