Repeated DNA Sequences
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.
- For example,
"ACGAATTCCG"is a DNA sequence.
When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences, or substrings, that occur more than once in a DNA molecule. You may return the answer in any order.
Example 1
Input
s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output
["AAAAACCCCC","CCCCCAAAAA"]The 10-letter-long sequences
"AAAAACCCCC" and "CCCCCAAAAA" each occur more than once.Example 2
Input
s = "AAAAAAAAAAAAA"Output
["AAAAAAAAAA"]The 10-letter-long sequence
"AAAAAAAAAA" occurs more than once in the string.Constraints
- 1 <= s.length <= 10^5
- s[i] is either 'A', 'C', 'G', or 'T'.